ID: 1025295922_1025295930

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1025295922 1025295930
Species Human (GRCh38) Human (GRCh38)
Location 7:57775293-57775315 7:57775336-57775358
Sequence CCATACCTGTCTTGGACAGCAAA CAAAGTGATGGCTGTGTAGTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!