ID: 1025304360_1025304366

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1025304360 1025304366
Species Human (GRCh38) Human (GRCh38)
Location 7:57842879-57842901 7:57842916-57842938
Sequence CCGTACACCTAGGCTCTATGGCA CAGGCTGCACACCTGGGCACAGG
Strand - +
Off-target summary No data {0: 4, 1: 2, 2: 8, 3: 30, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!