ID: 1025603822_1025603826

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1025603822 1025603826
Species Human (GRCh38) Human (GRCh38)
Location 7:63024522-63024544 7:63024536-63024558
Sequence CCAGCTTTTCCTCCACTATAACC ACTATAACCTTCGGCCTCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!