ID: 1025659838_1025659846

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1025659838 1025659846
Species Human (GRCh38) Human (GRCh38)
Location 7:63551048-63551070 7:63551089-63551111
Sequence CCGTCCACTGCATGCCTTGGAGG AACACAGCTCCCTCTGAGAAGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 0, 3: 21, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!