ID: 1025659838_1025659847

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1025659838 1025659847
Species Human (GRCh38) Human (GRCh38)
Location 7:63551048-63551070 7:63551090-63551112
Sequence CCGTCCACTGCATGCCTTGGAGG ACACAGCTCCCTCTGAGAAGGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 2, 3: 23, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!