ID: 1025715700_1025715707

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1025715700 1025715707
Species Human (GRCh38) Human (GRCh38)
Location 7:63953487-63953509 7:63953502-63953524
Sequence CCAAGAGCATGTCTCCCCAGGAG CCCAGGAGAGCTGGGGGCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!