ID: 1025819318_1025819329

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1025819318 1025819329
Species Human (GRCh38) Human (GRCh38)
Location 7:64947657-64947679 7:64947684-64947706
Sequence CCGCTGACGCCCGGTCGGGACGC CACCCTGTGTGGGGGCGGAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!