ID: 1025974573_1025974581

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1025974573 1025974581
Species Human (GRCh38) Human (GRCh38)
Location 7:66359486-66359508 7:66359536-66359558
Sequence CCTGGACACTTTAAGAACCTTAG GGTGCTGACCCCTGGACATCTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 0, 3: 8, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!