ID: 1025996069_1025996078

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1025996069 1025996078
Species Human (GRCh38) Human (GRCh38)
Location 7:66528276-66528298 7:66528318-66528340
Sequence CCTGCCTGCAAGGGGCTGAGACA GGCTGAACACCATTGGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 304} {0: 1, 1: 1, 2: 2, 3: 3, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!