ID: 1025997334_1025997339

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1025997334 1025997339
Species Human (GRCh38) Human (GRCh38)
Location 7:66536278-66536300 7:66536308-66536330
Sequence CCAGGGGCAGTGGGCAGGAGGTC CAGGGATGGGTTCTTTCAGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 52, 4: 452} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!