ID: 1026067674_1026067678

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1026067674 1026067678
Species Human (GRCh38) Human (GRCh38)
Location 7:67089397-67089419 7:67089422-67089444
Sequence CCTGCTGGTAAAGGTCGAAGCGC GGTGCGGAAGACTCCACTGCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 0, 4: 22} {0: 1, 1: 2, 2: 0, 3: 6, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!