ID: 1026088394_1026088404

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1026088394 1026088404
Species Human (GRCh38) Human (GRCh38)
Location 7:67280907-67280929 7:67280958-67280980
Sequence CCCTGTCTCTTCTAGAAGCACAA TGTAATCCCAGCTACTTGGGAGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206} {0: 48952, 1: 142577, 2: 242332, 3: 522592, 4: 386712}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!