ID: 1026418110_1026418113

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1026418110 1026418113
Species Human (GRCh38) Human (GRCh38)
Location 7:70204075-70204097 7:70204108-70204130
Sequence CCCTCTTTTATGTTTTTATTTTC ATACCAGTGATGTAAGATAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 38, 3: 589, 4: 8214} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!