ID: 1026482464_1026482473

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1026482464 1026482473
Species Human (GRCh38) Human (GRCh38)
Location 7:70790425-70790447 7:70790466-70790488
Sequence CCATCCGGGACCCCTTGAGGGAT ATTCACCGGAGAGACCCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!