ID: 1026639202_1026639206

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1026639202 1026639206
Species Human (GRCh38) Human (GRCh38)
Location 7:72109653-72109675 7:72109682-72109704
Sequence CCACTACTCAGCTTGAGGTCATG TGTGCTCAAGGACACTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78} {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!