ID: 1026822430_1026822433

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1026822430 1026822433
Species Human (GRCh38) Human (GRCh38)
Location 7:73558249-73558271 7:73558280-73558302
Sequence CCGTCAGCTATGATATGATCGCA TAGCCACTGCACTCCAGCCTGGG
Strand - +
Off-target summary No data {0: 571, 1: 10489, 2: 175158, 3: 257853, 4: 193506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!