ID: 1026822430_1026822435

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1026822430 1026822435
Species Human (GRCh38) Human (GRCh38)
Location 7:73558249-73558271 7:73558290-73558312
Sequence CCGTCAGCTATGATATGATCGCA ACTCCAGCCTGGGCAACATATGG
Strand - +
Off-target summary No data {0: 31, 1: 2369, 2: 8072, 3: 13033, 4: 13184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!