ID: 1026911751_1026911763

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1026911751 1026911763
Species Human (GRCh38) Human (GRCh38)
Location 7:74095158-74095180 7:74095208-74095230
Sequence CCCTTAAGGTCCCTCATCTCATC TCTCCTAGATTGTGGCCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!