ID: 1026911757_1026911765

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1026911757 1026911765
Species Human (GRCh38) Human (GRCh38)
Location 7:74095186-74095208 7:74095215-74095237
Sequence CCCAGTCTTTCCTACCTGCCTCT GATTGTGGCCCTTTGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!