ID: 1027111553_1027111560

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1027111553 1027111560
Species Human (GRCh38) Human (GRCh38)
Location 7:75443688-75443710 7:75443722-75443744
Sequence CCAGCACTTCGAAGGCGGAGGCG TGAGGTCAGGAGTTCAAGACCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 21, 3: 484, 4: 1882} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!