ID: 1027117996_1027118004

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1027117996 1027118004
Species Human (GRCh38) Human (GRCh38)
Location 7:75496212-75496234 7:75496260-75496282
Sequence CCCTGTCTCTTCTAGAAGCACAA ACCTGTAATCCCAGCTACTTGGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206} {0: 15366, 1: 98640, 2: 233329, 3: 337639, 4: 469862}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!