|
Left Crispr |
Right Crispr |
| Crispr ID |
1027117996 |
1027118006 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:75496212-75496234
|
7:75496263-75496285
|
| Sequence |
CCCTGTCTCTTCTAGAAGCACAA |
TGTAATCCCAGCTACTTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206} |
{0: 48952, 1: 142577, 2: 242332, 3: 522592, 4: 386712} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|