ID: 1027316776_1027316785

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1027316776 1027316785
Species Human (GRCh38) Human (GRCh38)
Location 7:76990544-76990566 7:76990572-76990594
Sequence CCCCTCCTTTTGCTCTCTGGGTA GCCTGATGACGGTGGGCGCTCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 26, 4: 296} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!