ID: 1027391657_1027391659

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1027391657 1027391659
Species Human (GRCh38) Human (GRCh38)
Location 7:77709742-77709764 7:77709760-77709782
Sequence CCCTTTGTACTCTTCTTTCTGGC CTGGCTTTTGCTAATTGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!