ID: 1027515446_1027515453

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1027515446 1027515453
Species Human (GRCh38) Human (GRCh38)
Location 7:79136918-79136940 7:79136934-79136956
Sequence CCTGATGCCTCCCATTGGTCCCA GGTCCCAGGGGTCCACCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!