ID: 1027691563_1027691566

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1027691563 1027691566
Species Human (GRCh38) Human (GRCh38)
Location 7:81353377-81353399 7:81353411-81353433
Sequence CCCAGATGTTCTTCGGGCTTCTT TCTAGATCACTAGCAAGATCAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 45, 3: 263, 4: 634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!