ID: 1027830543_1027830547

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1027830543 1027830547
Species Human (GRCh38) Human (GRCh38)
Location 7:83171526-83171548 7:83171545-83171567
Sequence CCCTTCAGAAGTGACTAGAGATG GATGAGAAGCCAAGTGCCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 15, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!