ID: 1027908224_1027908229

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1027908224 1027908229
Species Human (GRCh38) Human (GRCh38)
Location 7:84213830-84213852 7:84213866-84213888
Sequence CCTAGTACCAAATAGTACTTTCA AGGTTGCCCCAGCACTATCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 217} {0: 1, 1: 0, 2: 0, 3: 9, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!