ID: 1027963088_1027963092

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1027963088 1027963092
Species Human (GRCh38) Human (GRCh38)
Location 7:84971766-84971788 7:84971813-84971835
Sequence CCCTCCTCAAACTTAGCAAAGAG CTCATTCCAAAAACAGCAATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!