ID: 1028121393_1028121406

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1028121393 1028121406
Species Human (GRCh38) Human (GRCh38)
Location 7:87059637-87059659 7:87059688-87059710
Sequence CCGCCCGCTGACAGCTCTGCTGC GCTCCCGTCACGCCGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 236} {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!