ID: 1028121400_1028121406

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1028121400 1028121406
Species Human (GRCh38) Human (GRCh38)
Location 7:87059669-87059691 7:87059688-87059710
Sequence CCGGGCAGCCAGCGCCGATGCTC GCTCCCGTCACGCCGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 115} {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!