ID: 1028378603_1028378610

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1028378603 1028378610
Species Human (GRCh38) Human (GRCh38)
Location 7:90174212-90174234 7:90174262-90174284
Sequence CCAGGCATGATGATTCACATCAG TAAGAGAATTGCTTGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 306, 4: 2977} {0: 5, 1: 108, 2: 1779, 3: 15965, 4: 91150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!