ID: 1028747051_1028747053

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1028747051 1028747053
Species Human (GRCh38) Human (GRCh38)
Location 7:94338886-94338908 7:94338915-94338937
Sequence CCAAATAGTTGGCAATGCATGCA ATCAATTGTTCAAAATTTCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!