ID: 1028821252_1028821253

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1028821252 1028821253
Species Human (GRCh38) Human (GRCh38)
Location 7:95214413-95214435 7:95214426-95214448
Sequence CCTTGGGATGTGGGCCTCTCCCT GCCTCTCCCTGCTCATAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 366} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!