ID: 1029112070_1029112078

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1029112070 1029112078
Species Human (GRCh38) Human (GRCh38)
Location 7:98217612-98217634 7:98217652-98217674
Sequence CCCACAGTGGTCGTCCCGTCTTC CAAGGTGATAACACAGCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 44} {0: 1, 1: 0, 2: 0, 3: 16, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!