ID: 1029499999_1029500006

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1029499999 1029500006
Species Human (GRCh38) Human (GRCh38)
Location 7:100923096-100923118 7:100923119-100923141
Sequence CCTGCCTTGGTCCTTCACCCTTA GTGGAAAGTACCGCTTTTCTGGG
Strand - +
Off-target summary {0: 465, 1: 199, 2: 49, 3: 107, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!