ID: 1029500000_1029500006

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1029500000 1029500006
Species Human (GRCh38) Human (GRCh38)
Location 7:100923100-100923122 7:100923119-100923141
Sequence CCTTGGTCCTTCACCCTTAGTGG GTGGAAAGTACCGCTTTTCTGGG
Strand - +
Off-target summary {0: 93, 1: 326, 2: 368, 3: 366, 4: 369} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!