ID: 1029507547_1029507554

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1029507547 1029507554
Species Human (GRCh38) Human (GRCh38)
Location 7:100971444-100971466 7:100971479-100971501
Sequence CCTGCAGGACACCTTCGAGGTAA GTTCCACCATCCTCCCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 58} {0: 1, 1: 0, 2: 1, 3: 32, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!