ID: 1029507547_1029507558

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1029507547 1029507558
Species Human (GRCh38) Human (GRCh38)
Location 7:100971444-100971466 7:100971487-100971509
Sequence CCTGCAGGACACCTTCGAGGTAA ATCCTCCCAGCCAGGGACTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!