|
Left Crispr |
Right Crispr |
Crispr ID |
1029658347 |
1029658357 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:101942550-101942572
|
7:101942603-101942625
|
Sequence |
CCTCCTGGGCTTCAGCGATCCTC |
CAGATGCCTGCCACCACACCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 201, 2: 3029, 3: 16992, 4: 57734} |
{0: 97, 1: 2191, 2: 11870, 3: 35579, 4: 76031} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|