ID: 1029658348_1029658357

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1029658348 1029658357
Species Human (GRCh38) Human (GRCh38)
Location 7:101942553-101942575 7:101942603-101942625
Sequence CCTGGGCTTCAGCGATCCTCCCA CAGATGCCTGCCACCACACCCGG
Strand - +
Off-target summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889} {0: 97, 1: 2191, 2: 11870, 3: 35579, 4: 76031}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!