ID: 1029658354_1029658357

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1029658354 1029658357
Species Human (GRCh38) Human (GRCh38)
Location 7:101942585-101942607 7:101942603-101942625
Sequence CCCTAGCAGCTGAGACCACAGAT CAGATGCCTGCCACCACACCCGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 206, 3: 2459, 4: 20494} {0: 97, 1: 2191, 2: 11870, 3: 35579, 4: 76031}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!