|
Left Crispr |
Right Crispr |
| Crispr ID |
1029658354 |
1029658357 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:101942585-101942607
|
7:101942603-101942625
|
| Sequence |
CCCTAGCAGCTGAGACCACAGAT |
CAGATGCCTGCCACCACACCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 206, 3: 2459, 4: 20494} |
{0: 97, 1: 2191, 2: 11870, 3: 35579, 4: 76031} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|