ID: 1029675255_1029675268

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1029675255 1029675268
Species Human (GRCh38) Human (GRCh38)
Location 7:102064295-102064317 7:102064343-102064365
Sequence CCACCTTGGCCTCCCAAAGTGCT CCGGCTCTAAATGGTTTTAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 0, 3: 6, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!