ID: 1029724910_1029724921

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1029724910 1029724921
Species Human (GRCh38) Human (GRCh38)
Location 7:102396421-102396443 7:102396474-102396496
Sequence CCAGCCGCCTCCTCGGTGCGACC CGTCATCCCCAAGAATGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147} {0: 1, 1: 0, 2: 0, 3: 6, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!