ID: 1029726303_1029726307

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1029726303 1029726307
Species Human (GRCh38) Human (GRCh38)
Location 7:102407831-102407853 7:102407857-102407879
Sequence CCTGCAGCAGCTCTCGGGGCTAC CCTCCTCGATCTTGTCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!