ID: 1029741269_1029741286

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1029741269 1029741286
Species Human (GRCh38) Human (GRCh38)
Location 7:102493072-102493094 7:102493124-102493146
Sequence CCGGCCTCTCAGAGCCCCACTTG TGGGCGTCTTCGCGAAGCTGAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 35, 4: 440} {0: 4, 1: 0, 2: 0, 3: 5, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!