ID: 1029741275_1029741288

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1029741275 1029741288
Species Human (GRCh38) Human (GRCh38)
Location 7:102493095-102493117 7:102493131-102493153
Sequence CCGGCCTCCCTCCTTACCCACCT CTTCGCGAAGCTGAGGGCCTCGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 6, 3: 191, 4: 2870} {0: 4, 1: 0, 2: 0, 3: 5, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!