ID: 1029741278_1029741287

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1029741278 1029741287
Species Human (GRCh38) Human (GRCh38)
Location 7:102493102-102493124 7:102493125-102493147
Sequence CCCTCCTTACCCACCTTGGAGCT GGGCGTCTTCGCGAAGCTGAGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 3, 3: 15, 4: 236} {0: 4, 1: 0, 2: 0, 3: 0, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!