ID: 1029956681_1029956686

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1029956681 1029956686
Species Human (GRCh38) Human (GRCh38)
Location 7:104647751-104647773 7:104647772-104647794
Sequence CCATCTCTTTTATGTTCCTTTAG AGGAAGAAGGAGAAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 526} {0: 2, 1: 10, 2: 168, 3: 1248, 4: 6461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!