ID: 1029973193_1029973196

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1029973193 1029973196
Species Human (GRCh38) Human (GRCh38)
Location 7:104809439-104809461 7:104809454-104809476
Sequence CCACGTTCTGCCTTTGAGGCACT GAGGCACTCAACCTGGATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124} {0: 1, 1: 0, 2: 1, 3: 9, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!